>1|0 AGAGGUUCUUCAUGCCCCUUGUUAUCUGUAUUCCUAGGUUUUUAAUUCUCUUUGCAGCAAUUGUGAAUGGGAGUUCACACAUGAUUUGGCUCUCUGCUUGUCCAUUAUUGGUUUAUAGUAAU >2|0 GUUGGCCAGGCUGGGCUCAAACUCCUGACCUCAGGUGAUGCCCCUGCCUUGGCCUCCCAAAGUGCUGGGAUAACAGGCCUG
To use the classifier to predict viral circRNA from sequence, either:
Fasta must be the same format like sample (The length of the sequence must be greater than 5)
Press the "Submit" button to upload the sequences and begin the classification.
Waiting a moment and your results will be presented in web page.