Prediction of viral Circular RNA

Step.1: Input sequences in fasta format





  

Sample fasta Sequence(s)

>1|0
AGAGGUUCUUCAUGCCCCUUGUUAUCUGUAUUCCUAGGUUUUUAAUUCUCUUUGCAGCAAUUGUGAAUGGGAGUUCACACAUGAUUUGGCUCUCUGCUUGUCCAUUAUUGGUUUAUAGUAAU
>2|0
GUUGGCCAGGCUGGGCUCAAACUCCUGACCUCAGGUGAUGCCCCUGCCUUGGCCUCCCAAAGUGCUGGGAUAACAGGCCUG

Instructions

To use the classifier to predict viral circRNA from sequence, either:

  • paste your FASTA-formatted RNA sequences into the text area, or
  • upload a FASTA-formatted file with your RNA sequences.

Fasta must be the same format like sample (The length of the sequence must be greater than 5)

Press the "Submit" button to upload the sequences and begin the classification.

Waiting a moment and your results will be presented in web page.

Dependencies

  • Java 1.8.0_144
  • WEKA 3.8
  • Eclipse
  • Python 2.7.x
  • pandas
  • MRMD2.0